Wolfram Function Repository
Instant-use add-on functions for the Wolfram Language
Function Repository Resource:
Convert a given strand of DNA to a list of amino acids
ResourceFunction["DNAtoAminoAcid"][dna] converts the input DNA string to a list of amino acid entities. |
Convert the DNA strand “TACTTTTCGTCCGGTATAATT" to a list of amino acids:
In[1]:= |
Out[1]= |
Convert an invalid DNA strand with letters other than A/C/T/G:
In[2]:= |
Out[2]= |
Convert a DNA strand without a "TAC" present:
In[3]:= |
Out[3]= |
Create a visualization of the chain of amino acids by combining this with BioSequenceMoleculePlot:
In[4]:= |
Out[4]= |
This work is licensed under a Creative Commons Attribution 4.0 International License